Skip to content

Dializa otrzewnowa i nabłonkowe do mezenchymalnego przejścia komórek śródbłonka cd

3 miesiące ago

562 words

Fibroblasty węchowe uzyskano z trzech różnych próbek sieci przez intensywne traktowanie trypsyną po usunięciu komórek mezotelium (trzy 20-minutowe cykle ekspozycji na trypsynę). Wszystkie komórki hodowano w pożywce Earl s M199, 20 procent surowicy płodowej, 50 U penicyliny na mililitr, 50 .g streptomycyny na mililitr i 2 procent Biogro-2 (zawierającej insulinę, transferynę, etanoloaminę i putrescynę) (Biological Industries ). W celu przeprowadzenia eksperymentów komórki wysiano na folie po 50 .g kolagenu I na mililitr bez Biogro-2. Zakupiono TGF-.1 i interleukinę-1. (R & D), a zastosowane dawki mieściły się w zakresie wykrytym w płynach z dializą otrzewnową w obecności zapalenia otrzewnej24 i były podobne do tych stosowanych w poprzednich badaniach.9. Badanie zostało zatwierdzone przez komisji ds. etyki Hospital Universitario de la Princesa w Madrycie, a zgoda udzielona na podstawie ustnej zgody została udzielona wszystkim darczyńcom. Przeciwciała
Przeciwciała monoklonalne przeciwko CD151 (LIA1 / 1), CD9 (VJ1 / 20), integryna .3 (VJ1 / 18), integryna .1 (TS2 / 16) i integryna .2 (TEA1 / 41) zostały opisane w innym miejscu.25 Użyliśmy również monoklonalne przeciwciało przeciwko cząsteczce adhezji międzykomórkowej (ICAM-1) (HU5 / 3, dostarczone przez Dr. FW Luscinskas, Brigham and Women s Hospital, Boston); królicze przeciwciała poliklonalne przeciwko integrynie .2 i integrynie .3 (dostarczone przez Dr. G. Tarone, University of Turin, Turin, Italy); monoklonalne przeciwciało przeciwko E-kadherynie (Calbiochem); przeciwciała przeciwko wimentynie, . tubulinie i pancytokeratynie (Sigma); i przeciwciało monoklonalne przeciw ICAM-1 (Santa Cruz Biotechnology).
Cytometria przepływowa, analiza immunohistochemiczna, badania immunofluorescencyjne i mikroskopia konfokalna
Przeprowadzono badania metodą cytometrii przepływowej i immunofluorescencji, jak opisano wcześniej.25 Badania immunohistochemiczne przeprowadzono za pomocą metody streptawidyna-biotyna (Dako LSAB-2 Kit, Dako) na próbkach otrzewnej zatopionych w parafinie od 17 pacjentów poddanych ciągłej ambulatoryjnej dializie otrzewnowej i 8 kontrolnym pacjenci. Wszyscy pacjenci, u których wykonano biopsję, wyrazili pisemną, świadomą zgodę. Diaminobenzydyna i szybka czerwień były używane jako chromogeny do wizualizacji.
Western Blotting
Monowarstwy komórek mezotelialnych poddano lizie w buforze RIPA, a równoważne ilości białka rozdzielono przez elektroforezę z dodecylosiarczanem sodu-poliakryloamidem na żelu i Western blotting jak opisano wcześniej25. Obrazowanie przeprowadzono za pomocą kamery CCD LAS-1000 (Fujifilm) i sygnały zostały określone ilościowo za pomocą oprogramowania Image Gauge (wersja 3.46, Fujifilm).
Łańcuchowa reakcja polimerazy z odwrotną transkryptazą
Mezotelialny RNA ekstrahowano przy użyciu odczynnika (RNAwiz, Ambion). Komplementarny DNA uzyskano z .g całkowitego RNA za pomocą zestawu (Applied Biosystems). Amplifikację ślimaka przeprowadzono przez 40 cykli (40 sekund w 95 ° C, 30 sekund w 53 ° C i minutę w 72 ° C) przy użyciu startera (5 CACATCCTTCTCACTGCCATG3 ) i startera 2 (5 GCATCTAAACTCTAGTCTGC3 ). W przypadku zagnieżdżonej analizy ślimaka-łańcuchowej reakcji odwrotnej transkryptazy (RT-PCR) ślimaka przeprowadzono 30-cykliową reakcję w tych samych warunkach, a rozcieńczenie 1:50 produktu reakcji wzmocniono przez 20 cykli ( 40 sekund w 95 ° C, 30 sekund w 60 ° C i minuta w 70 ° C) z primerem i primerem 3 (5 CCTGAGTGGGGTGGGAGCTTCC3 ). 22 analizę PCR kadheryny przeprowadzono w 32 cyklach, jak opisano poprzednio.22
Testy migracji
Testy chemotaksji i haptotaksji (migracja w kierunku białek macierzy) przeprowadzono w poliwęglanowych wkładkach przejściowych (por 5 .m) [Costar]), z których niektóre pokryto na spodzie 10 .g kolagenu I lub lamininy-5 na mililitr, 26 jako wcześniej opisane.27
Upływowa mikroskopia elektronowa
Analiza wideomikroskopowa została przeprowadzona przy użyciu odwróconego mikroskopu wyposażonego w kamerę wideo (SSC-M350CE CCD, Sony) połączonego z magnetowidem typu time-lapse (SVT-5000P, Sony)
[więcej w: nzoz bydgoszcz, psychoterapia zabrze, forskolin apteka ]
[hasła pokrewne: lekarz medycyny pracy iława, ośrodki uzależnień od alkoholu, dyżury aptek stargard ]

0 thoughts on “Dializa otrzewnowa i nabłonkowe do mezenchymalnego przejścia komórek śródbłonka cd”